View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0269_low_12 (Length: 321)
Name: NF0269_low_12
Description: NF0269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0269_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 30 - 230
Target Start/End: Original strand, 38455049 - 38455245
Alignment:
Q |
30 |
ccagatatgtggatcaatatatctatctcagcacattattcaagggatcttggatcaaaaattgtaccaataattcgatattcatacccaaattgccctt |
129 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38455049 |
ccagatatgtggatcaatatatctatctcagcacattattcaagggatcttggatcacaaattgtaccaataattcgatattcatacccaaattgccctt |
38455148 |
T |
 |
Q |
130 |
ggccttggcctatatgtttgacattcttttgctaacatcccaacgtggagaatgaatgaatgaatgatagggtgcaacatcaatggtgcgtttgttccat |
229 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38455149 |
ggccttggcctatatgtttgacattcttttgctaacatcccaacgtgga----gaatgaatgaatgatagggtgcaacatcaatggtgcgtttgttccat |
38455244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University