View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0269_low_16 (Length: 297)
Name: NF0269_low_16
Description: NF0269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0269_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 30 - 282
Target Start/End: Complemental strand, 53598829 - 53598577
Alignment:
| Q |
30 |
gttgcaccatgaatgtcgataagttatgaagaaagacagtcatgaagagatggctcaacccatacatattcaatttctccataattctcccactcatgat |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53598829 |
gttgcaccatgaatgtcgataagttatgaagaaagacagtcatgaagagatggctcaacccatacatattcaatttctccataattctcccactcatgat |
53598730 |
T |
|
| Q |
130 |
tatatgtttannnnnnngtgcgttttgcatggaaagtcaccaccctctctatataacatgataagccatgtacaatattactggaatgcaagattcactt |
229 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53598729 |
tatatgtttatttttttgtgcgttttgcatggaaagtcaccaccctctctatataacatgataagccatgtacaatattactggaatgcaagattcactt |
53598630 |
T |
|
| Q |
230 |
agaagcgccaacatgtaccataacttataatgtacgataccctatatttgtgt |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53598629 |
agaagcgccaacatgtaccataacttataatgtacgataccctatatttgtgt |
53598577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1259 times since January 2019
Visitors: 2574