View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0269_low_18 (Length: 285)
Name: NF0269_low_18
Description: NF0269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0269_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 60 - 250
Target Start/End: Complemental strand, 40345130 - 40344939
Alignment:
| Q |
60 |
atcatcatcttatgcctaaattcaacgcctataacaatattttaactagagtttcataaaatcaatcaagatctgaaacaaatcaatcaaaaattaacac |
159 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40345130 |
atcataatcttatgcctaaattcaacgcctataacaatattttaactagagtttgataaaatcaatcaagatctgaaacaaatcaatcaaaaattaacac |
40345031 |
T |
|
| Q |
160 |
cagaaatcttgatttaattaaaataaagtttgaaataaactgacatgtaaaaa-tttattgacagttatattgaagcaaatcaatgagagag |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40345030 |
gagaaatcttgatttaattaaaataaagtttgaaataaactgacatgtaaaaagtttattgacagttatattgaaacaaatcaatgagagag |
40344939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1314 times since January 2019
Visitors: 2577