View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0269_low_19 (Length: 279)
Name: NF0269_low_19
Description: NF0269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0269_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 62 - 225
Target Start/End: Original strand, 22325131 - 22325294
Alignment:
Q |
62 |
aaatatttgacatggtatagttgtcatatctgagatgataatactatcagcagaatcctccttgaacatttggttaaaaacacttgactttgaaccaaga |
161 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
22325131 |
aaatatttgacatggtatagttgtcatatctgagatggtaatactatcaacagaatcctccttgaacatttggttaaaagcacttgactttgaaccaaga |
22325230 |
T |
 |
Q |
162 |
gcaaacttatgggccataatagtttgtttagatgcatcaatatagattgttgtgtcttcatctc |
225 |
Q |
|
|
||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
T |
22325231 |
gcatacttatgggccataatagtttgtttagatgcatcaatatagatttttgtgtctttatctc |
22325294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University