View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0269_low_21 (Length: 261)
Name: NF0269_low_21
Description: NF0269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0269_low_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 14944985 - 14944863
Alignment:
| Q |
1 |
cccgaaaaggagtgtacttgttgtatcgaaagaagatcttgagtacttattcgacggaggttgatccactgatcaccataggaacatgatcctatggtgg |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
14944985 |
cccgaaaaggagtgtactcgttgtatcgaaagaagatcttgagtacttattcgacggaggttgatccagtgatcaccataggagcatgatcctatggtgg |
14944886 |
T |
|
| Q |
101 |
tacagttgtagaagatgtacttg |
123 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
14944885 |
tacagttgtagaagatgtacttg |
14944863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 69; Significance: 5e-31; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 181 - 253
Target Start/End: Complemental strand, 34899975 - 34899903
Alignment:
| Q |
181 |
atctcaacttgaaagttgaaactaccaaactttacctatatgcatataaacacatctctctttagttcatctc |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34899975 |
atctcaacttgaaagttgaaactaccaaactttacctatatgcatataaacacatctctctttagttcttctc |
34899903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1322 times since January 2019
Visitors: 2577