View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0269_low_25 (Length: 226)
Name: NF0269_low_25
Description: NF0269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0269_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 16 - 179
Target Start/End: Complemental strand, 22325294 - 22325131
Alignment:
| Q |
16 |
gagatgaagacacaacaatctatattgatgcatctaaacaaactattatggcccataagtttgctcttggttcaaagtcaagtgtttttaaccaaatgtt |
115 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
22325294 |
gagataaagacacaaaaatctatattgatgcatctaaacaaactattatggcccataagtatgctcttggttcaaagtcaagtgcttttaaccaaatgtt |
22325195 |
T |
 |
| Q |
116 |
caaggaggattctgctgatagtattatcatctcagatatgacaactataccatgtcaaatattt |
179 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22325194 |
caaggaggattctgttgatagtattaccatctcagatatgacaactataccatgtcaaatattt |
22325131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University