View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0269_low_27 (Length: 216)
Name: NF0269_low_27
Description: NF0269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0269_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 22 - 185
Target Start/End: Original strand, 22325131 - 22325294
Alignment:
| Q |
22 |
aaatatttgacatggtatagttgtcatatctgagatgataatactatcagcagaatcctccttgaacattcggttaaaaacacttgactttgaaccaaga |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
22325131 |
aaatatttgacatggtatagttgtcatatctgagatggtaatactatcaacagaatcctccttgaacatttggttaaaagcacttgactttgaaccaaga |
22325230 |
T |
|
| Q |
122 |
gcaaacttatgggccataatagtttgtttagatgcatcaacatagattgttgtgtcttcatctc |
185 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||| ||||||| ||||||||| ||||| |
|
|
| T |
22325231 |
gcatacttatgggccataatagtttgtttagatgcatcaatatagatttttgtgtctttatctc |
22325294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1166 times since January 2019
Visitors: 2572