View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0269_low_31 (Length: 202)

Name: NF0269_low_31
Description: NF0269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0269_low_31
NF0269_low_31
[»] chr2 (1 HSPs)
chr2 (113-154)||(38455204-38455245)


Alignment Details
Target: chr2 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 113 - 154
Target Start/End: Complemental strand, 38455245 - 38455204
Alignment:
113 gatggaacaaacgcaccattgatgttgcaccctatcattcat 154  Q
    ||||||||||||||||||||||||||||||||||||||||||    
38455245 gatggaacaaacgcaccattgatgttgcaccctatcattcat 38455204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University