View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0269_low_9 (Length: 332)
Name: NF0269_low_9
Description: NF0269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0269_low_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 103; Significance: 3e-51; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 11 - 232
Target Start/End: Original strand, 32535701 - 32535921
Alignment:
| Q |
11 |
aatgagagcacataaatgatcatatatactttcaatccgaatcacatgaatggggatcatatactaaaatggataaaatctatctgtgtgtgannnnnnn |
110 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32535701 |
aatgagagcacataaatgatcatatttactttcaatccgaatcacatgaat-gggatcatatactaaaatagataaaatctatctgtgtgtgattttttt |
32535799 |
T |
 |
| Q |
111 |
nnnnnnnnnnnnnnnnnncttccaatttcttgtggacaaatctccaaaattacaaaaacatcttatactctcatacatgatataaacnnnnnnnntggtg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32535800 |
tctcttctagttttttttcttccaatttcttgtggacaaatctccaaaattacaaaaacatcttatactctcatacatgatataaacaaaaaaaatggtg |
32535899 |
T |
 |
| Q |
211 |
taggtgtaggatcaacaaaaat |
232 |
Q |
| |
|
|||| ||||||||||||||||| |
|
|
| T |
32535900 |
taggagtaggatcaacaaaaat |
32535921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University