View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0269_low_9 (Length: 332)

Name: NF0269_low_9
Description: NF0269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0269_low_9
NF0269_low_9
[»] chr6 (1 HSPs)
chr6 (11-232)||(32535701-32535921)


Alignment Details
Target: chr6 (Bit Score: 103; Significance: 3e-51; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 11 - 232
Target Start/End: Original strand, 32535701 - 32535921
Alignment:
11 aatgagagcacataaatgatcatatatactttcaatccgaatcacatgaatggggatcatatactaaaatggataaaatctatctgtgtgtgannnnnnn 110  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||           
32535701 aatgagagcacataaatgatcatatttactttcaatccgaatcacatgaat-gggatcatatactaaaatagataaaatctatctgtgtgtgattttttt 32535799  T
111 nnnnnnnnnnnnnnnnnncttccaatttcttgtggacaaatctccaaaattacaaaaacatcttatactctcatacatgatataaacnnnnnnnntggtg 210  Q
                      |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        |||||    
32535800 tctcttctagttttttttcttccaatttcttgtggacaaatctccaaaattacaaaaacatcttatactctcatacatgatataaacaaaaaaaatggtg 32535899  T
211 taggtgtaggatcaacaaaaat 232  Q
    |||| |||||||||||||||||    
32535900 taggagtaggatcaacaaaaat 32535921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1077 times since January 2019
Visitors: 2571