View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0271_high_10 (Length: 241)
Name: NF0271_high_10
Description: NF0271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0271_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 34139653 - 34139420
Alignment:
Q |
1 |
ttccaactgattatgccgtccgatatgtatctgctggaaggtattgtgttgtcacagttctttcttctcagtaactttgctcccttcattgtatatactg |
100 |
Q |
|
|
|||||||||||||||| | ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
34139653 |
ttccaactgattatgctgaccgatatgtttctgctggaaggtattgtgttgtcacagttctttcttctcagtaactttgcccccttcattgtatatactg |
34139554 |
T |
 |
Q |
101 |
caagtaagctttgtaattaatttaattagtcttcatgtttgtcaattaagttcacnnnnnnnctctgaagttaaaacactatgagttatctgtcacgttt |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| || |
|
|
T |
34139553 |
caagtaagctttgtaattaatttaattagtcttcatgtttgtcaattaagttcactttttttctctgaagttaaaacactatgagttatctgtcacggtt |
34139454 |
T |
 |
Q |
201 |
tggactcaaaattaaggcatggttggagaataat |
234 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
34139453 |
tggactcaaaattaaggcatggttggagaataat |
34139420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University