View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0271_high_17 (Length: 210)
Name: NF0271_high_17
Description: NF0271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0271_high_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 92; Significance: 7e-45; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 83 - 182
Target Start/End: Complemental strand, 18389859 - 18389760
Alignment:
Q |
83 |
aatggcaagaataatgagaagtggcttgttaaatcttttactattagtggtcttatttacaaatttattacactgttttgatgctcagcctgtgccaact |
182 |
Q |
|
|
|||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
18389859 |
aatggcaagaataatgagaagtagcttcttaaatcttttactattagtggtcttatttacaaatttattacactgttttgatgctcagcctgtgccaact |
18389760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University