View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0271_low_16 (Length: 234)
Name: NF0271_low_16
Description: NF0271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0271_low_16 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 14 - 234
Target Start/End: Complemental strand, 34140095 - 34139875
Alignment:
| Q |
14 |
agtcttaactttcacaacaagtgtttcttcagaaataatgtagtttcatatggcaacaaatacggtgcaagaaacttgacaccgcgatgcagcatctcac |
113 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34140095 |
agtcttaactttcacaagaagtgtttcttcagaaataatgtagtttcatatggcaacaaatacggtgcaagaaacttgacaccgcgatgcagcatctcat |
34139996 |
T |
 |
| Q |
114 |
ccgcaaggccttcttctcagccaagattcatccaacacaagaaagaagcattttggttttacaggtttttgtcaattgtatatgatcatataataaatcc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34139995 |
ccgcaaggccttcttctcagccaagattcatccaacacaagaaagaagcattttggttttacaggtttttgtcaattgtatatgatcatataataaatcc |
34139896 |
T |
 |
| Q |
214 |
aggtcattggactgaagacat |
234 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
34139895 |
aggtcattggactgaagacat |
34139875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 146 - 231
Target Start/End: Original strand, 31517187 - 31517272
Alignment:
| Q |
146 |
caacacaagaaagaagcattttggttttacaggtttttgtcaattgtatatgatcatataataaatccaggtcattggactgaaga |
231 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||| | |||||||| ||||| ||| | ||||| || ||||||||||||||||| |
|
|
| T |
31517187 |
caacacaaaaaagaagcattttggttttataggtttctttcaattgtgtatgaccatgttataaaccctggtcattggactgaaga |
31517272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University