View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0271_low_19 (Length: 217)

Name: NF0271_low_19
Description: NF0271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0271_low_19
NF0271_low_19
[»] chr8 (1 HSPs)
chr8 (21-99)||(5223643-5223721)


Alignment Details
Target: chr8 (Bit Score: 63; Significance: 1e-27; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 21 - 99
Target Start/End: Original strand, 5223643 - 5223721
Alignment:
21 attttcaattttctgatggtggttccactagacaccgatgcaatgaagtgtttggattgacgttcaatgatattttctt 99  Q
    |||||||| ||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||    
5223643 attttcaactttttgatggtggttcaactagacaccgatgcaatgaagtgtttggattgacgttcaatgatatattctt 5223721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University