View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0271_low_8 (Length: 285)
Name: NF0271_low_8
Description: NF0271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0271_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 30 - 277
Target Start/End: Complemental strand, 28439402 - 28439155
Alignment:
Q |
30 |
acaatcagctatcgtagataggcttatatttctgctgcaacactttctttgcttctatagtctttccatgttcaagtgcttgaatcacaaacatttatca |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28439402 |
acaatcagctatcgtagataggcttatatttctgctgcaacactttctttgcttctatagtctttccatgttcaagtgcttgaatcacaaacatttatca |
28439303 |
T |
 |
Q |
130 |
tgccaatgtgaatctcaatttgttgagtttgattttgtacattccaacaatatttcacacacacaacgttagacattaaatttcaagatatcgattgact |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28439302 |
tgccaatgtgaatctcaatttgttgagtttgattttgtacattccaacaatatttcacacacacaacgttagacattaaatttcaagatatcgattgact |
28439203 |
T |
 |
Q |
230 |
ggacaagttcatgttctgttatgtagacaattagattggagtattatc |
277 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28439202 |
ggacaagttcatgttctgttatgtagacaattagattggagtattatc |
28439155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University