View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0271_low_9 (Length: 285)
Name: NF0271_low_9
Description: NF0271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0271_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 30 - 273
Target Start/End: Complemental strand, 28439402 - 28439159
Alignment:
| Q |
30 |
acaatcagctatcgtagataggcttatatttctgctgcaacactttctttgcttctatagtctttccatgttcaagtgcttgaatcacaaacatttatca |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28439402 |
acaatcagctatcgtagataggcttatatttctgctgcaacactttctttgcttctatagtctttccatgttcaagtgcttgaatcacaaacatttatca |
28439303 |
T |
 |
| Q |
130 |
tgccaatgtgaatctcaatttgttgagtttgattttgtacattccaacaatatttcacacacacaacgttagacattaaatttcaagatatcgattgact |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28439302 |
tgccaatgtgaatctcaatttgttgagtttgattttgtacattccaacaatatttcacacacacaacgttagacattaaatttcaagatatcgattgact |
28439203 |
T |
 |
| Q |
230 |
ggacaagttcatgttctgttatgtagacaattagattggagtat |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28439202 |
ggacaagttcatgttctgttatgtagacaattagattggagtat |
28439159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University