View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0272-INSERTION-2 (Length: 248)
Name: NF0272-INSERTION-2
Description: NF0272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0272-INSERTION-2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 8 - 239
Target Start/End: Complemental strand, 33271779 - 33271548
Alignment:
| Q |
8 |
cataaaactaggtggccaagaaacattttgaaaatattgtaacttttgagatataactaatatttgaaaatggaaaaagcaataattagcaagcataaat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33271779 |
cataaaactaggtggccaagaaacattttgaaaatattgtaacttttgtgatataactaatatttgaaaatggaaaaagcaatatttagcaagcataaat |
33271680 |
T |
|
| Q |
108 |
agagagggggatttatactcatattcacaggctacatacattccattcccaactttatagattaaccaatctaagagatgccacaagacacaagcatcct |
207 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33271679 |
agagaggtggatttatactcatattcacaggctacatacattccattcccaactttatagattaaccaatctaagagatgccacaagacacaagtatcct |
33271580 |
T |
|
| Q |
208 |
ctcagtcatacatagccttcaaagaataatct |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
33271579 |
ctcagtcatacatagccttcaaagaataatct |
33271548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 493 times since January 2019
Visitors: 2566