View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0272-INSERTION-5 (Length: 690)
Name: NF0272-INSERTION-5
Description: NF0272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0272-INSERTION-5 |
 |  |
|
[»] chr4 (4 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-103; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 493 - 690
Target Start/End: Original strand, 31833291 - 31833489
Alignment:
Q |
493 |
aaccatccaatacttttgcttatttatgtgagagtagactacatgtattaatgtgacaaaa-aagagagtacgtgtattaaagaagtcaccgtgaaaact |
591 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
31833291 |
aaccatccaatacttttgcttatttatgtgagagtagactacatgtattaatgtgacaaaaaaagagagtacgtgtattaaagaagtcaccgtgaaaact |
31833390 |
T |
 |
Q |
592 |
tctcgagtcccacatgacctttaggttgaattgaattcaatgtgagaggatctaattccttcctttagatgatgtgttgcataaaagctgttttgtggc |
690 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31833391 |
tctcgagtcccacatgacctttaggttgaattgaattcaatgtgagaggatctaattccttcctttagatgatgtgttgcataaaagctgttttgtggc |
31833489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 270 - 351
Target Start/End: Original strand, 31833026 - 31833107
Alignment:
Q |
270 |
gagaaagtaagcatgtatcattgccaccaatatagttagttatttatcctttatagttagattattttattgttgcatattt |
351 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
T |
31833026 |
gagaaagtaagcatgtatcattgccaccaatatagttagttatttattctttatagttagatttttttattgttgcatattt |
31833107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 49 - 102
Target Start/End: Original strand, 31832756 - 31832809
Alignment:
Q |
49 |
atttgataatgtcggagttggatttcaaaatttagaaaacgttaatacagatat |
102 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31832756 |
atttgataatgtcggagttggatttcaaaatttagaaaacgttaatacagatat |
31832809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 123 - 157
Target Start/End: Original strand, 31832905 - 31832939
Alignment:
Q |
123 |
attattttgaattatttattgcaaaagaaaactag |
157 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |
|
|
T |
31832905 |
attattttaaattatttattgcaaaagaaaactag |
31832939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 366 - 394
Target Start/End: Original strand, 20895912 - 20895940
Alignment:
Q |
366 |
atccatttcatgacaaccttatttttctc |
394 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
20895912 |
atccatttcatgacaaccttatttttctc |
20895940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University