View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0272_high_13 (Length: 445)
Name: NF0272_high_13
Description: NF0272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0272_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 117 - 389
Target Start/End: Original strand, 1767337 - 1767601
Alignment:
| Q |
117 |
atctcacattctcttttgattatattcatttgttacactctctacaaccccggtcaatcatgggtaaaacatgttaaccatggtaaggttaacaactttg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1767337 |
atctcacattctcttttgattatattcatttgttacactctctacaaccccggtcaatcatgggtaaaacatgttaaccatggtaaggttaacaactttg |
1767436 |
T |
 |
| Q |
217 |
ttgcatgataagtgtcattttgcatgttgtggatttcgtgtaagctcagcaactatggaatgtaagttaagcagctaaataaactcgacaccgttactca |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1767437 |
ttgcatgataagtgtcattttgcatgttgtggatttcgtgtaagctcagcaactatggaatgtaagttaagcagctaaataaactcgacaccgttactca |
1767536 |
T |
 |
| Q |
317 |
ataatgtctctggtcaaaaactcaaaataatactactagtaatcctagcatttaatcacaacaataactatta |
389 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1767537 |
ataatgtctctgg--------tcaaaataatactactagtaatcctagcatttaatcacaacaataactatta |
1767601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 394 - 445
Target Start/End: Original strand, 1767903 - 1767954
Alignment:
| Q |
394 |
ttttttctttctctcttttgttagccttcacataaacctttgtttcttctct |
445 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||| | ||||||||||| |
|
|
| T |
1767903 |
ttttttctttctctcttttgttagccgtgacataaaccatagtttcttctct |
1767954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University