View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0272_high_15 (Length: 402)
Name: NF0272_high_15
Description: NF0272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0272_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 30 - 392
Target Start/End: Original strand, 34718695 - 34719050
Alignment:
| Q |
30 |
gttagtgttgttaattcttcaatttcatcgttcctttatgtttgccnnnnnnncgatcgattagggtttcgtttacgtaaccttttccccctttgtcatc |
129 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34718695 |
gttagtgttgttaat-cttcaatttcatcgttcctttatttttgcccttttttcgatcgattagggtttcgtttacgtaaccttttccccatttgtcatc |
34718793 |
T |
 |
| Q |
130 |
gtcgttaacctatgcctttatctcaccttcgattcatgaatcatttcgctgcttgaaaattggaatcatcagttcatcgtgtgtattgcatgatctatgt |
229 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34718794 |
gtcgctaacctatgcctttatctcaccttcgattcatgaatcgtttcgctgcttgaaaattggaatcatcagttcatcgtgtgtattgcatgatctatgt |
34718893 |
T |
 |
| Q |
230 |
cttgaacgc-ttttttgtagttgttgatttccttgaatattattgaaacagcgattaaagtggtttgaacttttctataatatattgttcaattaatnnn |
328 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
34718894 |
cttgaacgctttttttgtagttgttgatttccttgaatattattgaaacagcgattaaagtggtttgaacttttctataatatattgttcaattgataaa |
34718993 |
T |
 |
| Q |
329 |
nnnnnntatatatatcttttttgtttggtattaattggaaattctaacttttggttgctctgtg |
392 |
Q |
| |
|
| | |||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34718994 |
a------aaaaatatcttttttgtttggtattaattggaaa-tctaacttttggttgctctgtg |
34719050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University