View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0272_high_20 (Length: 316)
Name: NF0272_high_20
Description: NF0272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0272_high_20 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 8e-95; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 79 - 316
Target Start/End: Original strand, 37533364 - 37533602
Alignment:
| Q |
79 |
atgcaaatattttcgaaactatactgcaatcttttaattgctacacaaaactttcaagatattcctctagnnnnnnnnnnnnnnnnn-cttatgagatat |
177 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
37533364 |
atgcaaatattttcgaaactatactgtaatcttttaattgctacacaaaactttcaagatattcctctagaaaaaaaaaaaaaaaaaacttatgagatat |
37533463 |
T |
 |
| Q |
178 |
tttccaccttaatgggtatgcgaccaccgtgggaaagaaaaacaagtacaattatacaaagtcaactaatatgaacaagaggttatcaattagtactacg |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37533464 |
tttccaccttaatgggtatgcgaccaccgtgggaaagaaaaacaagtacaattatacaaagtcaactaatatgaacaagaggttatcaattagtactacg |
37533563 |
T |
 |
| Q |
278 |
aactagatgaggtgaagattaatcaacactgaatattgt |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37533564 |
aactagatgaggtgaagattaatcaacactgaatattgt |
37533602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 17 - 85
Target Start/End: Original strand, 37532504 - 37532572
Alignment:
| Q |
17 |
ttatcttttatctctcaagatttatacatgttgtttatcaaaccttttatttaaaaagtgatatgcaaa |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37532504 |
ttatcttttatctctcaagatttatacatgttgtttatcaaaccttttatttaaaaagtgatatgcaaa |
37532572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University