View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0272_high_23 (Length: 302)
Name: NF0272_high_23
Description: NF0272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0272_high_23 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 72; Significance: 9e-33; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 170 - 241
Target Start/End: Complemental strand, 26295326 - 26295255
Alignment:
| Q |
170 |
atatagacttgaaagtgaatttgagttttccctctctaagatcaagttgagaacatacttgtgcattttctt |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26295326 |
atatagacttgaaagtgaatttgagttttccctctctaagatcaagttgagaacatacttgtgcattttctt |
26295255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 80 - 128
Target Start/End: Complemental strand, 26295496 - 26295449
Alignment:
| Q |
80 |
aaaagtcactattaatttctatatatttaaacacttctaatttgaatgc |
128 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
26295496 |
aaaagtcactat-aatttctatatatttaaacacttctaatttgaatgc |
26295449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1042 times since January 2019
Visitors: 2571