View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0272_high_26 (Length: 294)
Name: NF0272_high_26
Description: NF0272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0272_high_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 60 - 131
Target Start/End: Complemental strand, 26600505 - 26600434
Alignment:
| Q |
60 |
atcaacataatgttatatgtattgaagatatgaaactaatatttttataatttaccttcaatgaaaagaaat |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26600505 |
atcaacataatgttatatgtattgaagatatgaaactagtatttttataatttaccttcaatgaaaagaaat |
26600434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 34718695 - 34718739
Alignment:
| Q |
7 |
gttagtgttgttaattcttcaatttcatcgttcctttatgtttgcc |
52 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
34718695 |
gttagtgttgttaat-cttcaatttcatcgttcctttatttttgcc |
34718739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University