View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0272_high_28 (Length: 271)

Name: NF0272_high_28
Description: NF0272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0272_high_28
NF0272_high_28
[»] chr7 (1 HSPs)
chr7 (1-174)||(49082856-49083029)


Alignment Details
Target: chr7 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 1 - 174
Target Start/End: Complemental strand, 49083029 - 49082856
Alignment:
1 aaatttagagggcgtgcataggcaaaacttacatgaggctaccnnnnnnnnnacctgcattaaatatttttgtgtgtggaagccacggaaccactagaat 100  Q
    ||||||||| ||||||||||||||||||||||||||||||  |           ||||||| |||||||||||||||||||||||| |||||||||||||    
49083029 aaatttagatggcgtgcataggcaaaacttacatgaggctcactatttttttcactgcattcaatatttttgtgtgtggaagccacagaaccactagaat 49082930  T
101 gattgcttgcagcattgttttctgcagaaacatcaagtttattctgtggaaatgttatgttttgaggaggcatg 174  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||    
49082929 gattgcttgcagcattgttttctgcagcaacatcaagtttattctgtggaaatgttatattttgaggaggcatg 49082856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University