View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0272_high_45 (Length: 234)
Name: NF0272_high_45
Description: NF0272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0272_high_45 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 20 - 145
Target Start/End: Original strand, 34718695 - 34718819
Alignment:
| Q |
20 |
gttagtgttgttaattcttcaatttcatcgttcctttatgtttgccnnnnnnncgatcgattagggtttcgtttacgtaaccttttccccctttgtcatc |
119 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34718695 |
gttagtgttgttaat-cttcaatttcatcgttcctttatttttgcccttttttcgatcgattagggtttcgtttacgtaaccttttccccatttgtcatc |
34718793 |
T |
|
| Q |
120 |
gtcgttaacctatgccttcatctcac |
145 |
Q |
| |
|
|||| ||||||||||||| ||||||| |
|
|
| T |
34718794 |
gtcgctaacctatgcctttatctcac |
34718819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2584 times since January 2019
Visitors: 2638