View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0272_low_24 (Length: 315)
Name: NF0272_low_24
Description: NF0272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0272_low_24 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 70 - 315
Target Start/End: Complemental strand, 169484 - 169234
Alignment:
| Q |
70 |
gtcgaagaatatcaaaatatataaaacgtgataaacatgcatgcatgtgatagttaacannnnnnnna-----agcttagtgattataattcacttttat |
164 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
169484 |
gtcgaagattatcaaaatatataaaacgtgataaacatgcatgcatgcgatagttaacattttttttttaagtagcttagtgattataattcacttttat |
169385 |
T |
|
| Q |
165 |
ggtaaataagcagagaatttaaggttcgaatctccacatattacaatgtattgtcattatcaactaatctatatttgcatggacaattaccatatttttc |
264 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
169384 |
ggtaaataagcagagaatttaaggtttgaatctccacatattacaatgcattgttattatcaactaatctatatttgcatggacaattaccatatttttc |
169285 |
T |
|
| Q |
265 |
tataaaatgggtctagagacaatgtaataagggttgcttagtgcatttcgg |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
169284 |
tataaaatgggtctagagacaatgtaataagggttgcttagtgtatttcgg |
169234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 823 times since January 2019
Visitors: 2568