View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0272_low_26 (Length: 302)

Name: NF0272_low_26
Description: NF0272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0272_low_26
NF0272_low_26
[»] chr6 (2 HSPs)
chr6 (170-241)||(26295255-26295326)
chr6 (80-128)||(26295449-26295496)


Alignment Details
Target: chr6 (Bit Score: 72; Significance: 9e-33; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 170 - 241
Target Start/End: Complemental strand, 26295326 - 26295255
Alignment:
170 atatagacttgaaagtgaatttgagttttccctctctaagatcaagttgagaacatacttgtgcattttctt 241  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26295326 atatagacttgaaagtgaatttgagttttccctctctaagatcaagttgagaacatacttgtgcattttctt 26295255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 80 - 128
Target Start/End: Complemental strand, 26295496 - 26295449
Alignment:
80 aaaagtcactattaatttctatatatttaaacacttctaatttgaatgc 128  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||    
26295496 aaaagtcactat-aatttctatatatttaaacacttctaatttgaatgc 26295449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 646 times since January 2019
Visitors: 2568