View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0272_low_31 (Length: 271)
Name: NF0272_low_31
Description: NF0272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0272_low_31 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 1 - 174
Target Start/End: Complemental strand, 49083029 - 49082856
Alignment:
Q |
1 |
aaatttagagggcgtgcataggcaaaacttacatgaggctaccnnnnnnnnnacctgcattaaatatttttgtgtgtggaagccacggaaccactagaat |
100 |
Q |
|
|
||||||||| |||||||||||||||||||||||||||||| | ||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
T |
49083029 |
aaatttagatggcgtgcataggcaaaacttacatgaggctcactatttttttcactgcattcaatatttttgtgtgtggaagccacagaaccactagaat |
49082930 |
T |
 |
Q |
101 |
gattgcttgcagcattgttttctgcagaaacatcaagtttattctgtggaaatgttatgttttgaggaggcatg |
174 |
Q |
|
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
49082929 |
gattgcttgcagcattgttttctgcagcaacatcaagtttattctgtggaaatgttatattttgaggaggcatg |
49082856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1054 times since January 2019
Visitors: 2571