View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0272_low_32 (Length: 269)
Name: NF0272_low_32
Description: NF0272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0272_low_32 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 30 - 235
Target Start/End: Complemental strand, 41078447 - 41078243
Alignment:
Q |
30 |
cactcactacactctatttagcctccatttagggtctataggggaggagagggaagtggaatgaaaaaagtttaattacaaatgtgtttggttcgaaata |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
T |
41078447 |
cactcactacactctatttagcctccatttagggtctataggggaggagagggaagtggaatgaaaaaagtttaatta-aaatgtgtttggttcaaaata |
41078349 |
T |
 |
Q |
130 |
tgaaaagagaggtattttaaaactaatttacaattttatctttatgatctgaccaaataacaannnnnnncttcgtgattaaaggaaataatactttaaa |
229 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||| || ||||||||||||||||||||||||||| |
|
|
T |
41078348 |
tgaaaagagagatattttaaaactaatttacaattttatctttatgatctgatcaaataacaatttttttctgcgtgattaaaggaaataatactttaaa |
41078249 |
T |
 |
Q |
230 |
tatatt |
235 |
Q |
|
|
|||||| |
|
|
T |
41078248 |
tatatt |
41078243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University