View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0274_high_4 (Length: 318)
Name: NF0274_high_4
Description: NF0274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0274_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 76 - 183
Target Start/End: Complemental strand, 21615223 - 21615116
Alignment:
| Q |
76 |
tgtatgatatcccaaattgttcgatccatttctcatgtttatttgatgaggaaggagaagggttcaaggacactactaggtcttatgatgacactaggtc |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21615223 |
tgtatgatatcccaaattgttcgatccatttctcatgtttatttgatgaggaaggagaagggttcaaggacactactaggtcttatgatgacactaggtc |
21615124 |
T |
 |
| Q |
176 |
atatcatc |
183 |
Q |
| |
|
|||||||| |
|
|
| T |
21615123 |
atatcatc |
21615116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 221 - 318
Target Start/End: Complemental strand, 21615076 - 21614979
Alignment:
| Q |
221 |
atgagttcataggtgctagaggctaaaaaaggacagaaaaataatgttgtggaagagaaaaatcgggccacgattttggaggagcgtctgattgatga |
318 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21615076 |
atgagttcataggtgctagaggttaaaaaaggacagaaaaataatgttgaggaagagaaaaatcgggccacgattttggaggagcgtctgattgatga |
21614979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University