View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0274_low_10 (Length: 212)
Name: NF0274_low_10
Description: NF0274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0274_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 3e-56; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 65 - 179
Target Start/End: Complemental strand, 37580231 - 37580117
Alignment:
Q |
65 |
gttcactgaatgtgtaaatgggtgaagttcctttgtttgacacgcattttgtcgcatactgggtttggacccaacttaatgtgacctctcattgcttaag |
164 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37580231 |
gttcattgaatgtgtaaatgggtgaagttcctttgtttgacacgcattttgtcgcatactgggtttggacccaacttaatgtgacctctcattgcttaag |
37580132 |
T |
 |
Q |
165 |
tgtaccgtcattcat |
179 |
Q |
|
|
||||||||||||||| |
|
|
T |
37580131 |
tgtaccgtcattcat |
37580117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 51759729 - 51759787
Alignment:
Q |
1 |
gcttttagagatcaaaatcaagcagcaaaataggttctagcatgacaaaacacaggttc |
59 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
51759729 |
gcttttagagatcaaaatcaagcagcaaaataggttctagcatgacaaaacataggttc |
51759787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 5 - 52
Target Start/End: Original strand, 6685133 - 6685180
Alignment:
Q |
5 |
ttagagatcaaaatcaagcagcaaaataggttctagcatgacaaaaca |
52 |
Q |
|
|
||||||||||||||||| ||||||||| |||||||||||||||||||| |
|
|
T |
6685133 |
ttagagatcaaaatcaaccagcaaaattggttctagcatgacaaaaca |
6685180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University