View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0274_low_6 (Length: 294)
Name: NF0274_low_6
Description: NF0274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0274_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 47 - 209
Target Start/End: Complemental strand, 37580279 - 37580117
Alignment:
Q |
47 |
aaaacatcacaatcctcatatttattttgggacaaactatgatgctgtgttcattgaatgtgtaaatgggtgaagttcctttgtttgacacgcattttgt |
146 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37580279 |
aaaacatcacaatcctcatatttattttgggacaaactatgatgccgtgttcattgaatgtgtaaatgggtgaagttcctttgtttgacacgcattttgt |
37580180 |
T |
 |
Q |
147 |
cgcatactgggtttggacccaacttaatgtgacctctcattgcttaagtgtaccgtcattcat |
209 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37580179 |
cgcatactgggtttggacccaacttaatgtgacctctcattgcttaagtgtaccgtcattcat |
37580117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University