View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0274_low_8 (Length: 272)
Name: NF0274_low_8
Description: NF0274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0274_low_8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 52 - 238
Target Start/End: Complemental strand, 3939975 - 3939781
Alignment:
| Q |
52 |
cattgctgttgcattttgatgttgtacacgaagatgcaaggttttcatacctctaatgactaggtatgcagaattctgttatcataaacatgtagca--- |
148 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3939975 |
cattgctgttgaattttgatgttgtacacgaagatgcaaggttttcatacctctaatgactaggtatgcagaattctgttatcataaacatgtagcaaca |
3939876 |
T |
|
| Q |
149 |
-----acatagtaactaaaaatatgcataatttctcgtnnnnnnnttaagtcaaaacatgtttaattcaaaggtgaagggaacaatcatgtagaa |
238 |
Q |
| |
|
|||||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3939875 |
tgtcaacatagtaactaaaaatatgtataatttctcataaaaaaattaagtcaaaacatgtttaattcaaaggtgaagggaacaatcatgtagaa |
3939781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 74 - 132
Target Start/End: Complemental strand, 2983946 - 2983888
Alignment:
| Q |
74 |
tgtacacgaagatgcaaggttttcatacctctaatgactaggtatgcagaattctgtta |
132 |
Q |
| |
|
|||||||||||||||| |||||||| ||||| |||| ||||||||||| ||||||||| |
|
|
| T |
2983946 |
tgtacacgaagatgcagcgttttcatgcctctgatgaataggtatgcagcattctgtta |
2983888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 255 times since January 2019
Visitors: 2563