View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0275_low_2 (Length: 325)
Name: NF0275_low_2
Description: NF0275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0275_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 37 - 312
Target Start/End: Original strand, 14037824 - 14038098
Alignment:
Q |
37 |
atcaatccatggaggaaaatgggttacacaagcgtcaaactcattcgcttcgtccattacaagtgtgtacgcttatttttctcgtcacttttacgtttca |
136 |
Q |
|
|
||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
14037824 |
atcaatccatggaggaaaatgggctatccaagcgtcaaactcattcgcttcgtccattacaagtgtgtacgcttatttttctcgtcacttt-acgtttca |
14037922 |
T |
 |
Q |
137 |
tttcataattttgttatttatatcatttaacttatgatcgagaaaagtctctctgatacatgttaaatgatatcaatagatgtctcaattatagtcttat |
236 |
Q |
|
|
||||||||||||| |||| |||||||||||||||| | ||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14037923 |
tttcataattttgctattgatatcatttaacttattagtgaggaaagtctctctgatacacgttaaatgatatcaatagatgtctcaattatagtcttat |
14038022 |
T |
 |
Q |
237 |
ataaatataaattttgaagtatttatttacaaaattactttgttagggtgactacaaacattggctagtgcaacag |
312 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
14038023 |
ataaatataaattttgaagtatttatttacaaaattactttgttagggtgactacaaacattggctagtggaacag |
14038098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University