View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0275_low_4 (Length: 278)
Name: NF0275_low_4
Description: NF0275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0275_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 2 - 265
Target Start/End: Complemental strand, 24782238 - 24781975
Alignment:
| Q |
2 |
tattcaactcatggaccggaactgactgctgccacaactggttgggcgtatcatgcgacgagaatactcgtcgtgtagccgatataaacctccgtgccgg |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24782238 |
tattcaactcatggaccggaactgactgctgccacaactggttgggcgtatcatgcgacgagaatactcgtcgcgtagccgatataaacctccgtgccgg |
24782139 |
T |
 |
| Q |
102 |
aactctctacaccaccttcgaaaaagcacgtaaacctggctacatgaccggtcaaatctccccggagatttgtaagctaactcaactttcaagcattaca |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
24782138 |
aactctctacaccaccttcgaaaaagcacgtaaacctggctacatgaccggtcaaatctccccggagatttgtaagctaactaaactttcaagcattaca |
24782039 |
T |
 |
| Q |
202 |
atcactgattggaacggtatctccggtgagatccccaagtgcatttcttcactttctttccttc |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24782038 |
atcactgattggaacggtatctccggtgagatccccaagtgcatttcttcactttctttccttc |
24781975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University