View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0276_high_15 (Length: 265)
Name: NF0276_high_15
Description: NF0276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0276_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 30431797 - 30431562
Alignment:
| Q |
1 |
caagacgtaaaatatcaccgtctttcagtttgacataaccccttcccttagcttggcctctaaacatatacaaattggaaattcacaatcagtataaaaa |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30431797 |
caagacgtaaaatatcatcgtctttcagtttgacataaccccttcccttagcttggcctctaaacatatacaaattggaaattcacaatcaatataaaaa |
30431698 |
T |
 |
| Q |
101 |
gagtttaattttcatccaccgtcggtataaaaagttttacatggttcacacatcataatcagtcatttgttcgactttagaagcaatgataataaaagcc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30431697 |
gagtttaattttcatccaccgtcggtataaaaagttttacatggttcacacatcataatcagtcatttgttcgactttagaagcagtgataataaaagcc |
30431598 |
T |
 |
| Q |
201 |
aaacattttttatgatccgactattatgatcaattg |
236 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30431597 |
aaacattttttatgatccgactgttatgatcaattg |
30431562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University