View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0276_low_12 (Length: 338)
Name: NF0276_low_12
Description: NF0276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0276_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 1 - 326
Target Start/End: Original strand, 30431889 - 30432214
Alignment:
| Q |
1 |
tgcaactttggtcctattttcctgtttttgtgccataacagaaccgctttgtagtgttagttaagtctcttttttcttcttccaatcgttgcaggtagct |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30431889 |
tgcaactttggtcctactttcctgtttttgtgcaataacagaacctctttgtattgttagttaagtctcttttttcttcttccaatcgttgcaggtagct |
30431988 |
T |
 |
| Q |
101 |
cctttgcttctactaggagctgagtatggccatcttattacaatttggaggctcagtgccatcggtgagacaatagtattacatattattgttcattgta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
30431989 |
cctttgcttctactaggagctgagtatggccatcttattacaatttggaggctcagtgccattggtgagacaatagtattacatattattgttcatagta |
30432088 |
T |
 |
| Q |
201 |
tgaataacatttattttccatatctttgttctcatagtgtacatatttatgagcaggattttttgtcagcttcagcgtgccgaagctttattcttgctac |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30432089 |
tgaataacatttattttccatatctttgttctcatagtgtacatatttatgagcaggattttttgtcaacttcagcgtgccgaagctttattcttgctac |
30432188 |
T |
 |
| Q |
301 |
tctgctcagatcaaccagcgaagtat |
326 |
Q |
| |
|
||||||||||||||||||||| |||| |
|
|
| T |
30432189 |
tctgctcagatcaaccagcgaggtat |
30432214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University