View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0276_low_14 (Length: 304)
Name: NF0276_low_14
Description: NF0276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0276_low_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 97; Significance: 1e-47; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 30 - 138
Target Start/End: Complemental strand, 1731565 - 1731457
Alignment:
| Q |
30 |
cataagacgtaactcaactcataaaatcaatattgttatactaaacaccttcacttgggtccgaacctgaacttctcaattgtgtgtgagtttcaggtgt |
129 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1731565 |
cataagacctaactcaactcataaaatcaatattgttatactaaacaccttcacttgggtccaaacctgaacttctcagttgtgtgtgagtttcaggtgt |
1731466 |
T |
 |
| Q |
130 |
cccaccatc |
138 |
Q |
| |
|
||||||||| |
|
|
| T |
1731465 |
cccaccatc |
1731457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 216 - 293
Target Start/End: Complemental strand, 1731388 - 1731311
Alignment:
| Q |
216 |
ggtaccataaaaactcatcagattaagaaaaatacctcgaaaaccaagatcagcatttccaagaaacagcatgttcat |
293 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1731388 |
ggtaccataaaaactcaacagattaagaaaaatacctcgaaaaccaagatcagcatttccaagaaacagcatgttcat |
1731311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University