View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0276_low_20 (Length: 265)
Name: NF0276_low_20
Description: NF0276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0276_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 30431773 - 30432011
Alignment:
Q |
1 |
aaagacggtgatattttacgtcttgcgaaattgattcttcctgcttcgaattttgcattttcgaagactacagagttgttctctggagaaccatccatga |
100 |
Q |
|
|
||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
30431773 |
aaagacgatgatattttacgtcttgcgaaattgattcttcctgctttgaattttgcattttcaaagactacagagttgttctctggagaaccatccatga |
30431872 |
T |
 |
Q |
101 |
ccctgaaagtaattcttgcaactttggtcctattttcctgtttttgtgcaataacagaacctctttgtagtgttagttaagtctcttttttcttcttcca |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
30431873 |
ccctgaaagtaattcttgcaactttggtcctactttcctgtttttgtgcaataacagaacctctttgtattgttagttaagtctcttttttcttcttcca |
30431972 |
T |
 |
Q |
201 |
atcgttgcaggtagctcctttgcttctactaggagctga |
239 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30431973 |
atcgttgcaggtagctcctttgcttctactaggagctga |
30432011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 9 - 113
Target Start/End: Original strand, 38775476 - 38775580
Alignment:
Q |
9 |
tgatattttacgtcttgcgaaattgattcttcctgcttcgaattttgcattttcgaagactacagagttgttctctggagaaccatccatgaccctgaaa |
108 |
Q |
|
|
|||| |||| |||||||| ||||||||||||||||||| ||||||||| |||| | ||||| || | | ||||| ||||||||||| |||||||| ||| |
|
|
T |
38775476 |
tgatgttttgcgtcttgcaaaattgattcttcctgctttaaattttgcaatttcaaggactagagtgctattctcaggagaaccatcaatgacccttaaa |
38775575 |
T |
 |
Q |
109 |
gtaat |
113 |
Q |
|
|
||||| |
|
|
T |
38775576 |
gtaat |
38775580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University