View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0276_low_29 (Length: 218)
Name: NF0276_low_29
Description: NF0276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0276_low_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 49; Significance: 3e-19; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 42 - 200
Target Start/End: Complemental strand, 9674865 - 9674685
Alignment:
Q |
42 |
gttgaaagtttggattgatgagagtaacaaaacagatggagtctgtc-----------attggagctttcgagtatga------------agttccttaa |
118 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||| | |||||| |||||||||| |
|
|
T |
9674865 |
gttgaaagtttggattgatgagaggaacaaaacagatggagtctgtccaatttgttgaattggagcttttgtgtatgatgcactctttctagttccttaa |
9674766 |
T |
 |
Q |
119 |
tctctaggggaaccatgcaacatgtttcatgtttgcnnnnnnnccaatcttgcaattaaaaaatgatgtaacatgtagaatg |
200 |
Q |
|
|
|||| ||| ||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |||||||||| |
|
|
T |
9674765 |
tctccaggagaaccatgcaacatgtttcatgtttgc-ttttttccaatcttgcaattaaaaaatgttgtaatatgtagaatg |
9674685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 87
Target Start/End: Complemental strand, 9687046 - 9686985
Alignment:
Q |
29 |
ataggaaagctgtgttgaaagtttggattgatgagag---taacaaaacagatggagtctgt |
87 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
T |
9687046 |
ataggaaagctgtgttgaaagtttggattgatgagaggaacaacaatacagatggagtctgt |
9686985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 42 - 80
Target Start/End: Complemental strand, 9688808 - 9688770
Alignment:
Q |
42 |
gttgaaagtttggattgatgagagtaacaaaacagatgg |
80 |
Q |
|
|
|||||||||||||| ||||||||| |||||||||||||| |
|
|
T |
9688808 |
gttgaaagtttggactgatgagaggaacaaaacagatgg |
9688770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 9684775 - 9684719
Alignment:
Q |
29 |
ataggaaagctgtgttgaaagtttggattgatgagagtaacaaaacagatggagtct |
85 |
Q |
|
|
||||||||||| ||||||||| ||| |||||||||| ||||||| |||||| |||| |
|
|
T |
9684775 |
ataggaaagctacgttgaaagtgtgggttgatgagaggaacaaaatagatggggtct |
9684719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University