View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0277_low_12 (Length: 265)
Name: NF0277_low_12
Description: NF0277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0277_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 171812 - 172047
Alignment:
Q |
1 |
aatttgaaagaggaagctgctctttctggccctgatcgtgttttcacatcaagaaaaattgaattgagaaaacaaaattcttattggcacggtagtactg |
100 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
171812 |
aatttgaaagaggaagctgctcttcctggccctgatcgtgttttcacatcaagaaaaattgaattgagaaaacaaaattcttattggcacggtagtactg |
171911 |
T |
 |
Q |
101 |
cacaattgtcaagattttctaattcagttgcaattcgaggtgattcacgaattgatatgagtggagactgtagtttgaactcacagtggttagaggatca |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
171912 |
cacaattgtcaagattttctaattcagttgcaattcgaggtgattcacaacttgatatgagtggagactgtagtttgaactcacagtggttagaggatca |
172011 |
T |
 |
Q |
201 |
gtttgatacgagatatagtcatttggatgatggtga |
236 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||| |
|
|
T |
172012 |
gtttgatatgagatatagtcatttggatgatggtga |
172047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University