View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0277_low_14 (Length: 257)
Name: NF0277_low_14
Description: NF0277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0277_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 123; Significance: 3e-63; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 29 - 244
Target Start/End: Original strand, 15843203 - 15843409
Alignment:
| Q |
29 |
actttatgctacttaaatttggtaaatgctcataagttagaacacttcaaccatataatatctcttatacatatannnnnnnaatggcaaatagatacca |
128 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||| |||||||| |||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
15843203 |
actttatgctgcttaaatttggtaaatgctcttaaattagaaca---------tataatatctcttatacatatatttttttaatggcaaatggatacca |
15843293 |
T |
 |
| Q |
129 |
gaacccactgaggccaaccgaatgaggatacaagatcattacaggttgtccagatagaccatacagcagaatggtagattaaccaaagaccgcgcctaag |
228 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||| || |||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
15843294 |
gaacccactgaggccaaccgaatgaggatgcgagatcatcacgggttgtccagatagaccatacagcagaatgctagattaaccaaagaccacgcctaag |
15843393 |
T |
 |
| Q |
229 |
cttatccctctctgct |
244 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
15843394 |
cttatccctctctgct |
15843409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 29 - 244
Target Start/End: Original strand, 15860312 - 15860518
Alignment:
| Q |
29 |
actttatgctacttaaatttggtaaatgctcataagttagaacacttcaaccatataatatctcttatacatatannnnnnnaatggcaaatagatacca |
128 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||| |||||||| |||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
15860312 |
actttatgctgcttaaatttggtaaatgctcttaaattagaaca---------tataatatctcttatacatatatttttttaatggcaaatggatacca |
15860402 |
T |
 |
| Q |
129 |
gaacccactgaggccaaccgaatgaggatacaagatcattacaggttgtccagatagaccatacagcagaatggtagattaaccaaagaccgcgcctaag |
228 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||| || |||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
15860403 |
gaacccactgaggccaaccgaatgaggatgcgagatcatcacgggttgtccagatagaccatacagcagaatgctagattaaccaaagaccacgcctaag |
15860502 |
T |
 |
| Q |
229 |
cttatccctctctgct |
244 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
15860503 |
cttatccctctctgct |
15860518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 198 - 244
Target Start/End: Original strand, 15471311 - 15471357
Alignment:
| Q |
198 |
aatggtagattaaccaaagaccgcgcctaagcttatccctctctgct |
244 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15471311 |
aatgctagattaaccaaagaccgtgcctaagcttatccctctctgct |
15471357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University