View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0277_low_15 (Length: 231)
Name: NF0277_low_15
Description: NF0277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0277_low_15 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 11 - 231
Target Start/End: Original strand, 14927365 - 14927585
Alignment:
Q |
11 |
gttatcgctctacagattgttagtgcttactaaaaactttgctatcattgttagtgcggaagaccgtaaattatagtacattatcattgtttgacatgtt |
110 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14927365 |
gttatcgctctacagattgttagtgcttactaaaaactttgctatcattgttagtgcggaagaccgtaaattatagtacattatcattgtttgacatgtt |
14927464 |
T |
 |
Q |
111 |
ggtcagatctgacaactcacaagttatttgcaacccgtgcggatttgcatagaacagtctacacacatgcaaaagtaaaggtgagcgatttcaacaaatt |
210 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14927465 |
ggtcagatctgacaactcacaagttatttgcaacccgtgctgatttgcatagaacagtctacacacatgcaaaagtaaaggtgagcgatttcaacaaatt |
14927564 |
T |
 |
Q |
211 |
tattaatggcaaaacaaatta |
231 |
Q |
|
|
||||||||||||||||||||| |
|
|
T |
14927565 |
tattaatggcaaaacaaatta |
14927585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University