View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0277_low_16 (Length: 205)
Name: NF0277_low_16
Description: NF0277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0277_low_16 |
 | |
|
| [»] scaffold0230 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 107
Target Start/End: Complemental strand, 23047213 - 23047107
Alignment:
| Q |
1 |
acaaacacaaacaattatacaaaaattggttttgtattgaagattaaaggctaaaggtggggtagtatggtgtggtggatacaaagaataaatgattgaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
23047213 |
acaaacacaaacaattatacaaaaattggttttgtattgaagattaaaggctaaaggtggggtagtatggtgtggtggatacaaagaatgaatgattgaa |
23047114 |
T |
|
| Q |
101 |
gatactg |
107 |
Q |
| |
|
||||||| |
|
|
| T |
23047113 |
gatactg |
23047107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 107
Target Start/End: Original strand, 44098489 - 44098595
Alignment:
| Q |
1 |
acaaacacaaacaattatacaaaaattggttttgtattgaagattaaaggctaaaggtggggtagtatggtgtggtggatacaaagaataaatgattgaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
44098489 |
acaaacacaaacaattatacaaaaattggttttgtattgaagattaaaggctaaaggtggggtagtatggtgtggtggatacaaagaatgaatgattgaa |
44098588 |
T |
|
| Q |
101 |
gatactg |
107 |
Q |
| |
|
||||||| |
|
|
| T |
44098589 |
gatactg |
44098595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0230 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: scaffold0230
Description:
Target: scaffold0230; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 20 - 63
Target Start/End: Original strand, 73 - 116
Alignment:
| Q |
20 |
caaaaattggttttgtattgaagattaaaggctaaaggtggggt |
63 |
Q |
| |
|
|||||||||| |||| |||||||| ||||||||||||||||||| |
|
|
| T |
73 |
caaaaattgggtttggattgaagaataaaggctaaaggtggggt |
116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 20 - 63
Target Start/End: Complemental strand, 18810949 - 18810906
Alignment:
| Q |
20 |
caaaaattggttttgtattgaagattaaaggctaaaggtggggt |
63 |
Q |
| |
|
|||||||||| |||| |||||||| ||||||||||||||||||| |
|
|
| T |
18810949 |
caaaaattgggtttggattgaagaataaaggctaaaggtggggt |
18810906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1043 times since January 2019
Visitors: 2571