View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0277_low_8 (Length: 308)
Name: NF0277_low_8
Description: NF0277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0277_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 36 - 286
Target Start/End: Original strand, 31836377 - 31836627
Alignment:
| Q |
36 |
gctttgaagactgaccagtttgcaaggctaagaagagaacttggagttgtatcatttttgttgtgattttgtattaagggatggtgttgtaagtaatacg |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31836377 |
gctttgaagactgaccagtttgcaaggctaagaagagaacttggagttgtatcatttttgttgtgattttgtattaagggatggtgttgtaagtaatacg |
31836476 |
T |
 |
| Q |
136 |
aaaccaattcagtttttacagttagtaattcagttagtgtaactgataatttgttacatagcagttcatataaataagtactagttgcactatgtagtat |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
31836477 |
aaaccaattcagtttttacagttagtaattcagttagtgtaactgataatttgttacatagcagttcatataaataagtactagttgcactatgtagtgt |
31836576 |
T |
 |
| Q |
236 |
ttgtgagaaattaataaaagttctcaagcttccctaatctctttctctctg |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31836577 |
gtgtgagaaattaataaaagttctcaagcttccctaatctctttctctctg |
31836627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University