View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0277_low_9 (Length: 300)
Name: NF0277_low_9
Description: NF0277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0277_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 1e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 65 - 222
Target Start/End: Complemental strand, 35915747 - 35915590
Alignment:
| Q |
65 |
attgggaagcagaatggaggaaaggctttgtctgcagatggaatcacacttggagaacaatttgtgtataaacatatggggagcatggcatcagtaggtg |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35915747 |
attgggaagcagaatggaggaaaggctttgtctgcagatggcatcacacttggagaacaatttgtgtataaacatatggggagcatggcatcagtaggtg |
35915648 |
T |
|
| Q |
165 |
cctataaggcacttgttgatctacgacaatccaaggtacaaatataatgggaaagttt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35915647 |
cctataaggcacttgttgatctacgacaatccaaggtacaaatataatgggaaagttt |
35915590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 814 times since January 2019
Visitors: 2568