View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0278_high_10 (Length: 231)
Name: NF0278_high_10
Description: NF0278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0278_high_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 142
Target Start/End: Complemental strand, 37547346 - 37547205
Alignment:
Q |
1 |
ctttagcttatgatgtttaattccacttgaggaattaacctttacaatatccattttatatacaataattgtcattcatacaaatttaagtaggattcaa |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37547346 |
ctttagcttatgatgtttaattccacttgaggaattaacctttacaatatccattttatatacaataattgtcattcatacaaatttaagtaggattcaa |
37547247 |
T |
 |
Q |
101 |
taattttttatacaggtataaatacgtatactctgcaaacct |
142 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
37547246 |
taattttttatacaggtataaatacatatactctgcaaacct |
37547205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University