View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0278_high_11 (Length: 217)
Name: NF0278_high_11
Description: NF0278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0278_high_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 16461840 - 16461653
Alignment:
| Q |
1 |
ccatgtccattaaaatctcttggggaacctttgggatcttttttattatagtatcttgctcctatcaattttctgcagttgttttaagaaattttaattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16461840 |
ccatgtccattaaaatctcttggggaacctttgggatcttttttattatagtatcttgctcctatcaattttctgcagttgttttaagaaattttaattt |
16461741 |
T |
|
| Q |
101 |
taaatagaatataaaatcgatacgaattttgtcaaaatccaaaatatgataatgaaaagagttagcaatagatgtgagcttttggtgc |
188 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16461740 |
taaatagaacataaaatcgatgcgaattttgtcaaaatccataatatgataatgaaaagagttagcaatagatgtgagcttttggtgc |
16461653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1332 times since January 2019
Visitors: 2577