View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0278_high_12 (Length: 216)
Name: NF0278_high_12
Description: NF0278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0278_high_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 195
Target Start/End: Original strand, 16461816 - 16462010
Alignment:
| Q |
1 |
ccccaagagattttaatggacatgggactcacactgcatcaacagcagctggtgtcattgttaacaatgctagttactatggtttagcaaaaggaacagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16461816 |
ccccaagagattttaatggacatgggactcacactgcatcaacagcagctggtgtcattgttaacaatgctagttactatggtttagcaaaaggaacagc |
16461915 |
T |
|
| Q |
101 |
aagaggtggttcaccttctgctaggattgctgcctataaagcatgctcaggagaaggttgctccggtggcactctattgaaggctattgatgatg |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16461916 |
aagaggtggttcaccttctgctaggattgctgcctataaagcatgctcaggagaaggttgctccggtggcactctattgaaggctattgatgatg |
16462010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 17 - 160
Target Start/End: Original strand, 16491738 - 16491881
Alignment:
| Q |
17 |
tggacatgggactcacactgcatcaacagcagctggtgtcattgttaacaatgctagttactatggtttagcaaaaggaacagcaagaggtggttcacct |
116 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| |||||| ||||| | ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16491738 |
tggacatggaactcacactgcatcaacagcagctggtgtcaatgttaataatgcaaattattatggtttagcaaaaggaacagcaagaggtggttcacct |
16491837 |
T |
|
| Q |
117 |
tctgctaggattgctgcctataaagcatgctcaggagaaggttg |
160 |
Q |
| |
|
|| |||||||||| ||||||||| |||| |||| ||||||||| |
|
|
| T |
16491838 |
tcaactaggattgccgcctataaaacatgttcagaagaaggttg |
16491881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 16 - 52
Target Start/End: Original strand, 8957197 - 8957233
Alignment:
| Q |
16 |
atggacatgggactcacactgcatcaacagcagctgg |
52 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
8957197 |
atggtcatgggactcacacttcatcaacagcagctgg |
8957233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1277 times since January 2019
Visitors: 2574