View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0278_high_8 (Length: 234)
Name: NF0278_high_8
Description: NF0278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0278_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 1 - 148
Target Start/End: Complemental strand, 40733389 - 40733242
Alignment:
Q |
1 |
gtattgaagttccacgttgacatgattatctgaatgatggatgtatacatgtactcacattcttattatttgagttaacttttgagagtgagatccaagt |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
40733389 |
gtattgaagttccacgttgacatgattatctgaatgatgaatgtatatatgtacttacattcttattatttgagttaacttttgagagtgagattcaagt |
40733290 |
T |
 |
Q |
101 |
ctacttaacactttaatcttttgaaccaagtttgttgttcaaatacga |
148 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40733289 |
ctacttaacactttaatcttttgaaccaagtttgttgttcaaatacga |
40733242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 345 times since January 2019
Visitors: 2564