View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0278_high_9 (Length: 233)
Name: NF0278_high_9
Description: NF0278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0278_high_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 161
Target Start/End: Original strand, 40733365 - 40733525
Alignment:
| Q |
1 |
tcatgtcaacgtggaacttcaatacaacttctatacacatcctcacgcccggcctgattcttgtgtctaattaccacactatcaattcttaattcgattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40733365 |
tcatgtcaacgtggaacttcaatacaacttctatacacatcctcacgcccagcctgattcttgtgtctaattaccacactatcaattcttaattcgattc |
40733464 |
T |
|
| Q |
101 |
tggtatcatgttaaacaagcatggatttaactctcaagagctagtttaaagaatgatgatg |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40733465 |
tggtatcatgttaaacaagcatggatttaactctcaagagctagtttaaagaatgatgatg |
40733525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1124 times since January 2019
Visitors: 2572